Functional Characterization of Novel ATP7B Variants for Diagnosis of Wilson Disease

Introduction

Wilson disease (WD; MIM#277900) is a rare, autosomal recessive, monogenetic disorder with a frequency of approximately 1:30,000 [1]. Diagnosis of WD represents a challenge to doctors, including pediatricians [2–4]. The disease manifests at various times throughout life with children representing a major portion of patients. Commonly, disease is diagnosed between 5 and 18 years, however some children below 5 years and elderly (> 60 years) can show first symptoms [5, 6]. WD results from mutations in the ATP7B gene. The gene encodes a large membrane-spanning P-type ATPase [7, 8]. ATP7B is predominately expressed in hepatocytes where it has two main functions: it is responsible for transfer of copper to apoceruloplasmin, which is secreted into the blood for copper supply to other organs, and—in case of excess copper—excretion from the body into the bile [9]. Clinical presentation with pure neurological symptoms in childhood, e.g., tremor or movement disorder, is rare, and most children show hepatic disease due to copper overload of the liver [10]. When left untreated, a severe, life-threatening disease evolves, including liver cirrhosis and/or severe neurodisability. Of note, effective, low-cost therapy has been established with copper chelators, mostly D-penicillamine (DPA) and trientine, or zinc [11]. However, therapy has to be taken lifelong and may result in side effects in a portion of the patients. An early start of the treatment in childhood is suggested to be of clinical benefit.

There is no single biochemical test for diagnosis of WD. A combination of individual assessments is indicative for diagnosis. Respective scores for diagnosis that includes various parameters of liver, including elevated levels of transaminases, and neurological disease have been developed [3, 12, 13]. One hallmark of the disease is the presence of a Kayser-Fleischer ring (KF) which is however absent in a significant portion of patients [14, 15]. Low serum ceruloplasmin and high liver copper are also highly suggestive but could be missed in patients with predominant neurological or psychiatric symptoms [16]. Significant delay of WD diagnosis is therefore not uncommon.

The only single assay to confirm WD is by genetic testing of ATP7B. Detection rates of up to 98% have been reported [17, 18]. More than 650 disease-causing mutations are currently known and novel SNPs are continuously reported. For novel mutations the prediction of penetrance is difficult. Most mutants of ATP7B are missense mutations which are proposed to reduce the function of the protein. To assess ATP7B function, primary specimens derived by biopsy from the patient are limited and also ethically restricted. Consequently, several cellular models reflecting the activity of ATP7B were established to predict the disease-causing impact of a given mutation. Such systems include yeast and several mammalian cell lines [19–22]. In this work we describe a case report of a child with a novel compound ATP7B mutation and relatively mild symptoms, where we have used a previously well characterized cell model to classify the functions of ATP7B for improved diagnosis of WD [23].

Materials and Methods

Clinical Presentation

Medical history, family medical history, clinical presentation, and biochemical parameters were recorded in the Department of Gastroenterology, Hepatology, Nutrition Disorders and Pediatrics of the Children's Memorial Health Institute Warsaw, Poland. Alanine transaminase (ALT), asparganine transaminase (AST), bilirubin, serum ceruloplasmin, rhodanine staining of hepatocytes, Kayser-Fleischer ring (KF), and 24 h urinary copper excretion were determined as reported [24]. After obtaining written informed consent, genomic DNA was extracted from peripheral blood samples and the complete open reading frame and adjacent intron boundaries of ATP7B were sequenced at the Medizinische Klinik B für Gastroenterologie und Hepatologie, Universitätsklinikum Münster, Germany. WD was diagnosed based on the Ferenci scoring system [25].

Cell Culture

HepG2 (human hepatocellular carcinoma) cells were purchased from American Type Culture Collection (ATCC) and ATP7B KO cells were derived as described [26]. RPMI medium (Lonza) containing 10% fetal bovine serum (FBS) was supplemented with 100 U/mL penicillin/streptomycin (PAA). Cells were maintained in 5% CO₂ at 37°C in a humidified chamber.

Site-Directed Mutagenesis And Generation of Stable ATP7B Mutant Cell Lines

Wild type ATP7B cDNA was cloned into plasmid pGCsamEN.ATP7B and site-directed mutagenesis was performed using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) [23]. The primer sequences were: p.L168P (5′-3′): GGCAAGGTCCGGAAACCGCAAGGAGTAGTGAG /CTCACTACTCCTTGCGGTTTCCGGACCTTGCC and p.S1423N (5′-3′): CCATGGGACCAGGTCAACTATGTCAGCCAGGT / ACCTGGCTGACATAGTTGACCTGGTCCCATGG. Retroviral vector transduced HepG2 KO cells were selected in media containing 6 μg/ml blasticidin (Invitrogen).

Western Blot

A polyclonal anti-rabbit ATP7B antibody (kind gift of Dr. I. Sandoval, Madrid, Spain) was used for Western blot. HSC70 (Santa Cruz Biotechnology, #sc-1059) staining was used as a protein loading control. Relative expression was normalized to HepG2 KO cells expressing wild type ATP7B [23].

MTT Assay

For cell viability assay triplicates of 10⁴ cells per 96 well were seeded and cultivated overnight in 100 μl RPMI media lacking phenol red (Lonza). Cells were exposed to copper (CuCl₂; Sigma Aldrich) for 48 h. Viability was determined by MTT assay [26]. The percentage of viable cells was calculated and compared to untreated (100%).

Copper Accumulation

For copper accumulation assay 10⁵ cells were seeded per 12 well, cultivated overnight and treated with 0.01 mM CuCl₂ for 4 h. Cells were washed twice, trypsinized and lyzed in 65% nitric acid (Merck). Bradford Assay (BioRad) was used to determine total protein concentration. Analysis of copper accumulation was performed via inductively coupled plasma mass spectrometry (Thermo Fisher Scientific iCAP Qc).

Real-Time PCR Analysis

RT-qPCR analysis was performed using SYBR Green PCR Core Plus (Eurogentec). Ct values were normalized to the expression of the house-keeping GAPDH gene (ΔΔct method). PCR analysis was conducted on the ABI Prism 7900 HT Sequence Detection System (PE Applied Biosystems). Following primer sequences were used: ATP7B (5′-3′): TCCTCTGTGTCTGTGGTGCTC / ATGCGCCTGTGCCTCATAC and GAPDH (5′-3′): CCCACTCCTCCACCTTTGAC / CCACCACCCTGTTCCTGTAG.

Confocal Staining

For confocal microscopy, cells were maintained in RPMI basal cell culture media or treated by addition of 100 μM copper for 3 h. Primary antibody staining was performed using anti-ATP7B (kind gift of Dr. I. Sandoval, Madrid, Spain) and anti-lamp2 (Santa Cruz Biotechnology, #sc-18822). Three independent experiments were performed. Microscopic images were recorded with an Observer Z1 microscope with Apotome, Axiocam MRm (Zeiss) [27].

Statistical Analysis

Statistical analysis was performed by Kruskal-Wallis 1-way ANOVA and Student's t-test using SPSS 22.0 software. Data are given as mean ± standard error (SE).

Results

Patient History

The clinical characterization of the patient is illustrated in Table 1. At the age of thirteen, the boy was hospitalized following episodes of paranoia, uncommon tics, Tourette syndrome and three attempted suicides. MRI was performed, showing typical images according to age. Serum transaminases were within normal thresholds. Ceruloplasmin was low (0.13 g/L) at one occasion, while a second determination showed normal values (0.22 g/L). Liver biopsy was performed indicating micro- and macrovesicular steatosis with no signs of necrosis, fibrosis or cholestasis. Liver copper was in the normal range. Urine copper concentration was highly elevated (>5 fold) after cuprenil challenge [28]. A previously reported, disease-causing heterozygous p.L168P (c.503T > C) mutation was detected in ATP7B [29]. A second, unknown heterozygous ATP7B variant p.S1423N (c.4268G > A) was observed. The parents were shown to be asymptomatic heterozygotic carriers (Figures 1A–D). Genetic analysis of the patient also revealed a p.TA7/7 mutation in UGT1A1 indicating Gilbert syndrome. DPA and zinc acetate treatment lead to no further reports of neurological and hepatic disease. According to the diagnosing of WD using the Ferenci scoring system an overall score of 4 was determined [25].

TABLE 1

Table 1. Patient characteristics.

FIGURE 1

Figure 1. Identification and expression of ATP7B mutants p.L168P and p.S1423N. (A,B) Sequence analysis of the patient shows a compound heterozygote p.L168P (A) and p.S1423N (B) mutation. (C,D) The respective sequences derived from the father (C) and mother (D) are also depicted. (E) ATP7B mRNA expression of both variants was determined by RT-qPCR analysis. Mean/SE are given (n = 3). (F) Densitometry determination of ATP7B protein expression relative to wild type is shown. Mean/SE are given (n = 3). *P < 0.05. (G) One typical Western blot is shown.

Expression Profile of Novel ATP7B Variants

Since functional characterization of ATP7B mutants is not possible using patient materials and biopsy represents a risk especially for children, a previously established cellular model was used to functionally characterize the mutations of the patient [23]. While mRNA expression of the ATP7B variants p.L168P and p.S1423N was in the same range as observed for wild type (Figure 1E), protein expression/stability was significantly affected in both mutants of the mutants p.L168P and p.S1423N (34.3 ± 8% and 66.0 ± 8%, respectively) (Figures 1F,G). Incubation at low temperature (30°C) could marginally increase protein stability for mutants p.L168P and p.S1423N (factor of ≈1.4 and ≈1.2, respectively).

Characterization of ATP7B Mediated Copper Transport

ATP7B activity of both mutants as judged by viability of cells was similar to wild type at most copper concentrations (Figure 2A). IC50 values calculated for p.L168P and p.S1423N were similar (0.87 ± 0.06 mM and 0.89 ± 0.05 mM, respectively) and close to wild type ATP7B. The accumulated cellular copper concentration was significantly reduced (≤47.9 ± 8%) in both ATP7B mutants as compared to wild type (Figure 2B). Values of both mutants were in the same range as observed in ATP7B knockout cells. Confocal microscopy was used to analyze ATP7B trafficking relative to wildtype cells (Supplementary Figure S1). For mutant p.L168P, ATP7B staining was dispersed cytoplasmically at both copper concentrations (Figure 3). A broad co-localization with anti-lamp2, a late endosome-lysosome marker, as observed before for wild type was not detected [23]. For p.S1423N, a co-localization of ATP7B and lamp2 staining was found at low copper concentrations. The ATP7B staining pattern obtained with this mutant moderately responded to elevated copper.

FIGURE 2

Figure 2. (A) Cell viability was determined after exposure to copper. Viability of cells relative to untreated (100%) is shown. Mean/SE are given (n = 3). *P < 0.05. (B) Analysis of intracellular Cu accumulation. Mean/SE are given (n = 3). *P < 0.05.

FIGURE 3

Figure 3. Confocal microscopy before and after addition of copper. For mutant p.L168P, a dispersed cytoplasmically staining of ATP7B was observed at low and high copper. For mutant p.S1423N, a co-localization with late endosome-lysosome marker lamp2 was observed at low copper concentrations. Elevated copper did not show typical trafficking of this mutant. One representative experiment out of three is shown. Scale bar, 20 μm.

Discussion

We here report on the diagnosis of a boy who has a novel compound heterozygote ATP7B mutation, no family history of WD, and subtle neuropsychiatric symptoms without hepatic disease. In this and other cases, WD diagnosis can be delayed due to highly variable symptoms and low awareness of the disease. Symptoms are rarely observed before the age of 5 years [5, 30, 31]. In the first decade, the majority of children present with hepatic symptoms. Liver disease is often accidentally revealed by routine analysis of serum showing elevated levels of hepatic transaminases which represent important first-line indicators of WD. However, the detection rate of elevated transaminases in children having WD is variable [32, 33]. While the Ferenci scoring system for diagnosis of WD includes parameters, e.g., Kayser-Fleischer rings, which are rarely observed in young children, some of the thresholds used for scoring have been adapted to children [28]. The only single parameter confirming WD is by genetic analysis of ATP7B. Genetic testing was proposed for children where liver disease of unknown origin is observed [3, 5]. Irrespective of the presence of liver disease, a family history of WD is highly suggestive for genetic testing. Extrahepatic presentation of WD as observed in the case described here is uncommon at young age. In children presenting with dystonia, tremor, dysarthria and/or impaired school performance, WD should be however carefully taken into account.

The reported case is unusual with respect to a pure psychiatric disease manifestation observed in childhood [34]. All clinical, biochemical, and histological findings considered, the diagnosis of WD for the patient is tentative, since definite hallmarks of the disease, like Kayser-Fleischer ring or elevated liver copper, are missing and overall relatively mild symptoms are observed. One determination of ceruloplasmin was indicative for WD, while a second assay performed in the same year was above thresholds. Of note, around 20% of diagnosed children (and adults) have CP levels above the threshold of 20 mg/dL limiting the value of this diagnostic parameter [35–39]. Elevated urine copper after penicillamine treatment corroborated WD diagnosis. It should be mentioned however that this assay is constrained in children, since collection of urine may be difficult. Tic syndromes are rather uncommon in WD patients but have been occasionally associated with the disease [40]. In addition, the patient displayed a mutation in UGT1A1 indicating Gilbert syndrome and total and indirect bilirubin was elevated. However, jaundice was not reported. Although we cannot fully rule out a multiple disorder of the patient, the general clinical picture seems to be in agreement with WD as the principal underlying disease. Our finding of a borderline positive WD diagnosis score could be significantly modulated by the young age of the patient which precludes a full manifestation of the disease [6, 10].

The genetic analysis of ATP7B in the patient revealed one previously reported disease-causing mutation p.L168P [29], while the second mutation p.S1423N was of unknown status. Variant p.S12423N was not observed in healthy individuals and could not be found in public data banks suggesting that this is not a polymorphism (data not shown). The mutation p.L168P has been reported in a 33 year old female in compound with mutation p.H1069Q, the most frequent mutation found worldwide which is associated with late-onset neurological disease [6]. The woman was diagnosed following the presentation of seizures and episodes of unconsciousness shortly after a cesarean section was performed. Neurological disease was not reported and zinc sulfate treatment resulted in functional improvement suggesting that mutation p.L168P may be associated with a relative mild course of disease. However, apart from this report, a coherent phenotype of p.L168P observed in homozygous WD patients has not been reported. While mutation p.L168P, located in the second copper binding domain of ATPase 7B, is predicted to alter the function of the protein, such analyses gave unambiguous results for p.S1423N (data not shown). The latter mutation is located in the cytosolic portion of ATPase 7B close to the C-terminal end, possibly important for protein trafficking [9].

To molecularly assess the function of the ATP7B gene products, we have employed a hepatic cell model, since hepatocytes represent the best studied cells where various biological functions of the copper transporter have been characterized [20, 26]. Given the almost pure neuropsychiatric symptoms of the patient, it would be interesting to re-address our findings in neuronal cell lines, which are however less established for assessment of WD to date. First, ATP7B-specific protein expression of mutants p.L168P and p.S1423N was found to be greatly reduced. The low protein expression could only be marginally increased by low temperature suggesting that in contrast to other mutations of ATP7B, a decreased translation might be operative [41]. Second, analysis of the cell viability in the presence of toxic copper indicates that mutants p.L168P and p.S1423N are mildly impaired with only marginal functional losses as compared to wild type. Of note, the viability assay employed here can detect various degrees of ATP7B activity, as exemplified by the moderate or deleterious loss-of-function mutations p.H1069Q/p.L795F and p.C271*, respectively [23]. Third, the assessment of intracellular copper accumulation revealed that both mutations have almost completely lost the ability to store copper and showed similar values as observed for knockout cells, whereas overexpression of ATP7B resulted in an increase of copper previously also observed in Chinese Hamster Ovary (CHO) cells [19]. This latter finding suggests that the copper accumulation assay and the viability assay may rely on distinct functions of ATPase 7B. As suggested earlier, copper is translocated to intracellular vesicles via ATP7B leading to increased copper concentrations [19]. Fourth, protein trafficking, a functional hallmark of the ATP7B protein, was significantly disturbed in both mutants. Mutant p.S1423N did not respond to high copper suggesting that the amino acid change at position 1423 might affect the nearby DKWSLL traffic signal that was found to be important for regulation of the transport between the trans-Golgi network (TGN) and the plasma membrane [42]. Trafficking of mutant p.L168P showed a copper dependent response, however lost a specific trans-Golgi localization. Our analysis of protein trafficking is however restricted, since quantification of protein localization relative to marker protein was not performed. Such quantitative analyses awaits further standardization, while different markers and experimental settings have been used [43–45]. Our molecular characterizations therefore indicate that both mutants exhibit distinct, non-overlapping impairments of ATP7B protein function which show different degrees of impact depending on the functional assay used for the determination.

Taken together, molecular characterization of novel ATP7B variants may help to functionally categorize the mutation and to assist in early WD diagnosis. The functional characterization of ATP7B gene products is straightforward and can be achieved within several weeks in order to initiate efficient therapy. However, when the impairment of ATP7B function is relative mild, as in the case reported here, such analysis can be ambiguous. In addition, our molecular analyses has to be subjected to further standardization by a large collection of mutated proteins which is far from being achieved in our and other studies [19–21, 23, 45]. The case reported here thus demonstrates current limitations of genetic analysis even when combined with advanced functional characterizations of ATP7B gene products. Given the evolving methodologies of high-throughput mutagenesis, improved cellular models to predict loss-of-function seem to be on the horizon, especially for monogenetic, severe disorders of childhood where efficient treatment is available.

Ethic Statement

This study was conducted according to the guidelines laid down in the Declaration of Helsinki and all procedures involving human subjects/patients were approved by the Ethics Committee of the Children's Memorial Health Institute (Children's Memorial Health Institute, Warsaw, Poland; approval granted in 2003). All patients and/or parents gave written informed consent.

Author Contributions

Study concept and design: SG, PS, HS, and AZ. Experiment and procedures: SG, FB , MN, UM, SRG, and PS. Results interpretation and drafting of the manuscript: SG, FB, UM, SRG, and AZ. Critical revision of the manuscript for important intellectual content: SG, MN, PS, HS, and AZ.

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Acknowledgments

We are grateful to O. Nadzemova and V. Sauer for technical assistance and U. Karst for copper analysis.

Supplementary Material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fped.2018.00106/full#supplementary-material

Abbreviations

WD, Wilson disease; DPA, D-Penicillamine; KF, Kayser-Fleischer ring; Cu, copper.

References

1. Ala A, Walker AP, Ashkan K, Dooley JS, Schilsky ML. Wilson's disease. Lancet (2007) 369:397–408. doi: 10.1016/S0140-6736(07)60196-2

CrossRef Full Text | Google Scholar

2. Rukunuzzaman M. Wilson's disease in bangladeshi children: analysis of 100 cases. Pediatr Gastroenterol Hepatol Nutr. (2015) 18:121–7. doi: 10.5223/pghn.2015.18.2.121

PubMed Abstract | CrossRef Full Text | Google Scholar

3. Seo JK. Diagnosis of Wilson disease in young children: molecular genetic testing and a paradigm shift from the laboratory diagnosis. Pediatr Gastroenterol Hepatol Nutr. (2012) 15:197–209. doi: 10.5223/pghn.2012.15.4.197

PubMed Abstract | CrossRef Full Text | Google Scholar

4. Sturm E, Piersma FE, Tanner MS, Socha P, Roberts EA, Shneider BL. Controversies and variation in diagnosing and treating children with Wilson disease: results of an international survey. J Pediatr Gastroenterol Nutr. (2016) 63:82–7. doi: 10.1097/MPG.0000000000001102

PubMed Abstract | CrossRef Full Text | Google Scholar

5. Wiernicka A, Dadalski M, Janczyk W, Kaminska D, Naorniakowska M, Husing-Kabar A, et al. Early onset of Wilson disease: diagnostic challenges. J Pediatr Gastroenterol Nutr. (2017) 65:555–60. doi: 10.1097/MPG.0000000000001700

PubMed Abstract | CrossRef Full Text | Google Scholar

6. Ferenci P, Czlonkowska A, Merle U, Ferenc S, Gromadzka G, Yurdaydin C, et al. Late-onset Wilson's disease. Gastroenterology (2007) 132:1294–8. doi: 10.1053/j.gastro.2007.02.057

PubMed Abstract | CrossRef Full Text | Google Scholar

7. Bull PC, Thomas GR, Rommens JM, Forbes JR, Cox DW. The Wilson disease gene is a putative copper transporting P-type ATPase similar to the Menkes gene. Nat Genet. (1993) 5:327–37. doi: 10.1038/ng1293-327

PubMed Abstract | CrossRef Full Text | Google Scholar

8. Tanzi RE, Petrukhin K, Chernov I, Pellequer JL, Wasco W, Ross B, et al. The Wilson disease gene is a copper transporting ATPase with homology to the Menkes disease gene. Nat. Genet. (1993) 5:344–50. doi: 10.1038/ng1293-344

PubMed Abstract | CrossRef Full Text | Google Scholar

9. Lutsenko S. Copper trafficking to the secretory pathway. Metallomics (2016) 8:840–52. doi: 10.1039/C6MT00176A

PubMed Abstract | CrossRef Full Text | Google Scholar

10. Merle U, Schaefer M, Ferenci P, Stremmel W. Clinical presentation, diagnosis and long-term outcome of Wilson's disease: a cohort study. Gut (2007) 56:115–20. doi: 10.1136/gut.2005.087262

PubMed Abstract | CrossRef Full Text | Google Scholar

11. Roberts EA, Schilsky ML. Diagnosis and treatment of Wilson disease: an update. Hepatology (2008) 47:2089–111. doi: 10.1002/hep.22261

PubMed Abstract | CrossRef Full Text | Google Scholar

12. Noureen N, Rana, MT. Neurological Wilson disease in children: a three years experience from Multan. J Pak Med Assoc. (2011) 61:743–8.

PubMed Abstract | Google Scholar

13. Iorio R, D'Ambrosi M, Marcellini M, Barbera C, Maggiore G, Zancan L, et al. Serum transaminases in children with Wilson's disease. J Pediatr Gastroenterol Nutr. (2004) 39:331–6. doi: 10.1097/00005176-200410000-00006

PubMed Abstract | CrossRef Full Text

14. European association for study of liver. EASL Clinical Practice Guidelines: Wilson's disease. J Hepatol. (2012) 56:671–85. doi: 10.1016/j.jhep.2011.11.007.

CrossRef Full Text

15. Caprai S, Loudianos G, Massei F, Gori L, Lovicu M, Maggiore G. Direct diagnosis of Wilson disease by molecular genetics. J Pediatr. (2006) 148:138–40. doi: 10.1016/j.jpeds.2005.07.036

PubMed Abstract | CrossRef Full Text | Google Scholar

16. Jesse M, Dempsey R, Eshelman A, Moonka D. Screening for Wilson's disease: which tests are good enough? Liver Transpl. (2014) 20:1525–26. doi: 10.1002/lt.23984

PubMed Abstract | CrossRef Full Text | Google Scholar

17. Coffey AJ, Durkie M, Hague S, McLay K, Emmerson J, Lo C, et al. A genetic study of Wilson's disease in the United Kingdom. Brain (2013) 136:1476–87. doi: 10.1093/brain/awt035

PubMed Abstract | CrossRef Full Text | Google Scholar

18. Schmidt HHJ. Role of genotyping in Wilson's disease. J Hepatol. (2009) 50:449–52. doi: 10.1016/j.jhep.2008.11.008

PubMed Abstract | CrossRef Full Text | Google Scholar

19. Cater MA, La Fontaine S, Shield K, Deal Y, Mercer JFB. ATP7B mediates vesicular sequestration of copper: Insight into biliary copper excretion. Gastroenterology (2006) 130:493–506. doi: 10.1053/j.gastro.2005.10.054

PubMed Abstract | CrossRef Full Text | Google Scholar

20. Huster D, Hoppert M, Lutsenko S, Zinke J, Lehmann C, Mossner J, et al. Defective cellular localization of mutant ATP7B in Wilson's disease patients and hepatoma cell lines. Gastroenterology (2003) 124:335–45. doi: 10.1053/gast.2003.50066

PubMed Abstract | CrossRef Full Text | Google Scholar

21. Tsivkovskii R, Eisses JF, Kaplan JH, Lutsenko S. Functional properties of the copper-transporting ATPase ATP7B (the Wilson's disease protein) expressed in insect cells. J Biol Chem. (2002) 277:976–83. doi: 10.1074/jbc.M109368200

PubMed Abstract | CrossRef Full Text | Google Scholar

22. Iida M, Terada K, Sambongi Y, Wakabayashi T, Miura N, Koyama K, et al. Analysis of functional domains of Wilson disease protein (ATP7B) in Saccharomyces cerevisiae. FEBS Lett. (1998) 428:281–5. doi: 10.1016/S0014-5793(98)00546-8

PubMed Abstract | CrossRef Full Text | Google Scholar

23. Chandhok G, Horvath J, Aggarwal A, Bhatt M, Zibert A, Schmidt HH. Functional analysis and drug response to zinc and D-penicillamine in stable ATP7B mutant hepatic cell lines. World J Gastroenterol. (2016) 22:4109–19. doi: 10.3748/wjg.v22.i16.4109

PubMed Abstract | CrossRef Full Text | Google Scholar

24. Wisniewska M, Cremer M, Wiehe L, Becker NP, Rijntjes E, Martitz J, et al. Copper to zinc ratio as disease biomarker in neonates with early-onset congenital infections. Nutrients (2017) 9:343. doi: 10.3390/nu9040343

PubMed Abstract | CrossRef Full Text | Google Scholar

25. Ferenci P, Caca K, Loudianos G, Mieli-Vergani G, Tanner S, Sternlieb I, et al. Diagnosis and phenotypic classification of Wilson disease1. Liver Int. (2003) 23:139–42. doi: 10.1034/j.1600-0676.2003.00824.x

CrossRef Full Text | Google Scholar

26. Chandhok G, Schmitt N, Sauer V, Aggarwal A, Bhatt M, Schmidt HHJ. The effect of zinc and D-penicillamine in a stable human hepatoma ATP7B knockout cell line. PLoS ONE (2014) 9:e98809. doi: 10.1371/journal.pone.0098809

PubMed Abstract | CrossRef Full Text | Google Scholar

27. Djuric I, Siebrasse JP, Schulze U, Granado D, Schluter MA, Kubitscheck U, et al. The C-terminal domain controls the mobility of Crumbs 3 isoforms. Biochim Biophys Acta (2016) 1863:1208–17. doi: 10.1016/j.bbamcr.2016.03.008

PubMed Abstract | CrossRef Full Text | Google Scholar

28. Patil M, Sheth KA, Krishnamurthy AC, Devarbhav H. A review and current perspective on Wilson disease. J Clin Exp Hepatol. (2013) 3:321–36. doi: 10.1016/j.jceh.2013.06.002

PubMed Abstract | CrossRef Full Text | Google Scholar

29. Czlonkowska A, Gromadzka G, Buttner J, Chabik G. Clinical features of hemolysis, elevated liver enzymes, and low platelet count syndrome in undiagnosed Wilson disease: report of two cases. Arch Gynecol Obstet. (2010) 281:129–34. doi: 10.1007/s00404-009-1080-6

PubMed Abstract | CrossRef Full Text | Google Scholar

30. Wilson DC, Phillips MJ, Cox DW, Roberts EA. Severe hepatic Wilson's disease in preschool-aged children. J Pediatr. (2000) 137:719–22. doi: 10.1067/mpd.2000.108569

PubMed Abstract | CrossRef Full Text | Google Scholar

31. Lin LJ, Wang DX, Ding NN, Lin Y, Jin Y, Zheng CQ. Comprehensive analysis on clinical features of Wilson's disease: an experience over 28 years with 133 cases. Neurol Res. (2014) 36:157–63. doi: 10.1179/1743132813Y.0000000262

PubMed Abstract | CrossRef Full Text | Google Scholar

32. O'Connor J, Sokol R. Copper metabolism and copper storage disorders. In: Suchy F, Sokol R, Balistreri W, editors. Liver Diseases in Children 3rd Edn. New York, NY: Cambridge University Press (2007). p. 626–59.

33. Iorio R, D'Ambrosi M, Mazzarella G, Varrella F, Vecchione R, Vegnente A. Early occurrence of hypertransaminasemia in a 13-month-old child with Wilson disease. J Pediatr Gastroenterol Nutr. (2003) 36:637–8. doi: 10.1097/00005176-200305000-00009

PubMed Abstract | CrossRef Full Text | Google Scholar

34. Svetel M, Potrebic A, Pekmezovic T, Tomic A, Kresojevic N, Jesic R, et al. Neuropsychiatric aspects of treated Wilson's disease. Parkinsonism Relat Disord. (2009) 15:772–5. doi: 10.1016/j.parkreldis.2009.01.010

PubMed Abstract | CrossRef Full Text | Google Scholar

35. Dhawan A, Taylor RM, Cheeseman P, De Silva P, Katsiyiannakis L, Mieli-Vergani G. Wilson's disease in children: 37-year experience and revised King's score for liver transplantation. Liver Transpl. (2005) 11:441–8. doi: 10.1002/lt.20352

PubMed Abstract | CrossRef Full Text | Google Scholar

36. Mak CM, Lam CW, Tam S. Diagnostic accuracy of serum ceruloplasmin in Wilson disease: determination of sensitivity and specificity by ROC curve analysis among ATP7B-genotyped subjects. Clin Chem. (2008) 54:1356–62. doi: 10.1373/clinchem.2008.103432

PubMed Abstract | CrossRef Full Text | Google Scholar

37. Nicastro E, Ranucci G, Vajro P, Vegnente A, Iorio R. Re-evaluation of the diagnostic criteria for Wilson disease in children with mild liver disease. Hepatology (2010) 52:1948–56. doi: 10.1002/hep.23910

PubMed Abstract | CrossRef Full Text | Google Scholar

38. Kim JA, Kim HJ, Cho JM, Oh SH, Lee BH, Kim GH, et al. Diagnostic value of ceruloplasmin in the diagnosis of pediatric Wilson's disease. Pediatr Gastroenterol Hepatol Nutr. (2015) 18:187–92. doi: 10.5223/pghn.2015.18.3.187

PubMed Abstract | CrossRef Full Text | Google Scholar

39. Wang JS, Lu Y, Wang XH, Zhu QR. Urinary copper/zinc ratio: a promising parameter for replacement of 24-hour urinary copper excretion for diagnosis of Wilson's disease in children. World J Pediatr. (2010) 6:148–53. doi: 10.1007/s12519-010-0023-4

PubMed Abstract | CrossRef Full Text | Google Scholar

40. Arruda WO, Munhoz RP, de Bem RS, Deguti MM, Barbosa ER, Zavala JA, et al. Pathogenic compound heterozygous ATP7B mutations with hypoceruloplasminaemia without clinical features of Wilson's disease. J Clin Neurosci. (2014) 21:333–6. doi: 10.1016/j.jocn.2013.02.030

PubMed Abstract | CrossRef Full Text

41. van den Berghe PV, Stapelbroek JM, Krieger E, Bie P, van de Graaf SF, Groot RE, et al. Reduced expression of ATP7B affected by Wilson disease-causing mutations is rescued by pharmacological folding chaperones 4-phenylbutyrate and curcumin. Hepatology (2009) 50:1783–95. doi: 10.1002/hep.23209

CrossRef Full Text

42. Lalioti V, Hernandez-Tiedra S, Sandoval IV. DKWSLLL, a versatile DXXXLL-type signal with distinct roles in the Cu(+)-regulated trafficking of ATP7B. Traffic (2014) 15:839–60. doi: 10.1111/tra.12176

PubMed Abstract | CrossRef Full Text | Google Scholar

43. Lalioti V, Peiro R, Perez-Berlanga M, Tsuchiya Y, Munoz A, Villalba T, et al. Basolateral sorting and transcytosis define the Cu+-regulated translocation of ATP7B to the bile canaliculus. J Cell Sci. (2016) 129:2190–201. doi: 10.1242/jcs.184663

PubMed Abstract | CrossRef Full Text | Google Scholar

44. Zhu M, Dong Y, Ni W, Wu ZY. Defective roles of ATP7B missense mutations in cellular copper tolerance and copper excretion. Mol Cell Neurosci. (2015) 67:31–6. doi: 10.1016/j.mcn.2015.05.005

PubMed Abstract | CrossRef Full Text | Google Scholar

45. Forbes JR, Cox DW. Functional characterization of missense mutations in ATP7B: Wilson disease mutation or normal variant? Am J Hum Genet. (1998) 63:1663–74. doi: 10.1086/302163

CrossRef Full Text | Google Scholar